-->

''Και όμως κινείται'' (E pur si muove). Και όμως τα τέστ PCR είναι αφερέγγυα.


Κάθε επιστήμη έχει προχωρήσει και έχει προοδεύσει, γιατί ακριβώς υπήρχαν κάποιοι επιστήμονες, συνήθως εκτός του κατεστημένου δόγματος που αμφέβαλλαν μόνιμα και αμφισβητούσαν τα πάντα. 

Ας μην ξεχνάμε ότι το κατεστημένο δόγμα δίωξε αρκετούς επιστήμονες που τόλμησαν να πουν τα προηγούμενα χρόνια, ότι η γή κινείται, Γαλιλαίος ''Και όμως κινείται'' (E pur si muove). Kαι η Βιταμίνη C έγινε αποδεκτή και ξεκίνησε να θεραπεύεται το σκορβούτο μετά απο 200 χρόνια.

Επομένως σαν επιστήμονας κανείς δεν έχει το θέσφατο.

Ούτε οι επιστήμονες του κατεστημένου δόγματος, αλλά ούτε και αυτοί που διαφωνούν.

Οσο για την καραμέλα της παραπληροφόρησης από πότε οι διαφορετικές θεωρίες στην επιστήμη είναι παραπληροφόρηση; Και γιατί αυτή την συγκεκριμένη εποχή άρχισαν όλοι με την καραμέλα της παραπληροφόρησης και της λογοκρισίας;

Επιστρέφομε στην εποχή του Μέτερνιχ, θα αρχίσουμε να καίμε βιβλία;;

Και τι και ποιό σκοπό εξυπηρετεί αυτός ο τρόπος αντιπαράθεσης;

Που βοηθάει ο στιγματισμός και η διαίρεση;;

Πάντως όχι την επιστήμη, αλλά ούτε τον άνθρωπο και γενικά την ανθρωπότητα.

Ευχαριστώ τη σελίδα και τα άτομα που ασχολήθηκαν με τις παρα πληροφορητικές μου δηλώσεις και ελπίζω πραγματικά να αναζητούν την αλήθεια, εάν και το ύφος του κειμένου λαϊκίζει, κιτρινίζει λίγο, προσπαθώντας χωρίς να γνωρίζουν κάποιον να μειώσουν την επάρκεια του στο γνωστικό του αντικείμενο, αυτό δεν είναι πραγματική αναζήτηση της γνώσης, σαν εντεταλμένη εργασία φαίνεται, αλλά το προσπερνάω και πιστεύω πραγματικά ότι μπορεί να γίνει ένας εποικοδομητικός διάλογος.

Ας πάμε να δούμε την ''παραπληροφόρηση''  

https://www.facebook.com/443945345616907/posts/4058828614128544/

Καταρχάς η ειδίκευση μου είναι στην Βιοχημεία, εάν κάποιος θέλει να εντρυφήσει και σε άλλες επιστήμες όπως στην Μετεωρολογία ή στην Οικολογία και Περιβάλλον δεν νομίζω ότι είναι ατόπημα και ότι μειώνει τις γνώσεις του στα άλλα επιστημονικά γνωσιακά αντικείμενα, το αντίθετο, αποκτά σφαιρική άποψη.

Το πρώτο θέμα της παραπληροφόρησης  είναι “Τα τεστ είναι τελείως αφερέγγυα” 

Σύμφωνα με τα λεγόμενα , αλλά και με τα γραφόμενα του κυρίου Drosten, τα παραθέτω πιο κάτω.

Στις 31 Δεκεμβρίου 2019: η κυβέρνηση στο Πεκίνο στέλνει μια ομάδα ιολόγων και επιδημιολόγων για να εξακριβώσει τι συμβαίνει στη Γουχάν.

Στίς 1η Ιανουαρίου 2020:Μια μέρα μετά. Ο καθηγητής Christian Drosten από το Charité, ο υπεύθυνος και αυτός που έβγαλε το πρωτόκολλο για την PCR για να ανιχνεύει τον Sars-Cov 2, το ακούει και αμέσως αρχίζει να αναπτύσσει τέστ για ιούς SARS, προτού οι Κινέζοι ιολόγοι δημοσιεύσουν τα αποτελέσματά τους. Μόλιςτην προηγούμενη ημέρα οι Κινέζοι είχαν στείλει την ομάδα τους στη Γουχάν για να δούν τι συμβαίνει.

Οσο για τα social media ο ίδιος το αναφέρει στην δημοσίευση του.

https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

Results

‘’Before public release of virus sequences from cases of 2019-nCoV, we relied on social media reports announcing detection of a SARS-like virus. We thus assumed that a SARS-related CoV is involved in the outbreak. We downloaded all complete and partial (if > 400 nt) SARS-related virus sequences available in GenBank by 1 January 2020.The list (n = 729 entries) was manually checked and artificial sequences (laboratory-derived, synthetic, etc), as well as sequence duplicates were removed, resulting in a final list of 375 sequences.’’ 



‘’Πριν από τη δημοσίευση αλληλουχιών ιών από περιπτώσεις 2019-nCoV, βασιζόμενοι σε αναφορές κοινωνικών μέσων που ανακοινώνουν την ανίχνευση ενός ιού τύπου SARS. Υποθέσαμε λοιπόν ότι ένας CoV που σχετίζεται με το SARS εμπλέκεται στο ξέσπασμα.( αυθαίρετη η συσχέτιση του ιού με το ξέσπασμα εκείνη τη χρονική περίοδο) Πραγματοποιήσαμε λήψη όλων των ολοκληρωμένων και μερικών (εάν> 400 nt) αλληλουχιών ιών που σχετίζονται με το SARS και είναι διαθέσιμες στη GenBank έως την 1η Ιανουαρίου 2020.Η λίστα (n = 729 καταχωρήσεις) ελέγχθηκε με μη αυτόματο τρόπο και οι τεχνητές ακολουθίες (εργαστηριακές, συνθετικές κ.λπ.), καθώς και τα αντίγραφα αλληλουχίας αφαιρέθηκαν, με αποτέλεσμα μια τελική λίστα 375 ακολουθιών.''

Ολη η παραπάνω παράγραφος αναφέρεται απο τους ελεγκτές σχεδόν επι λέξη χωρίς να αναφαίρουν τα social media. Δεν το είδαν όταν το διαβάζαν;

Πότε σύμφωνα με τα λεγόμενα πάντα του Christian Drosten δημοσιεύτηκε το γονιδίωμα;; Στην εισαγωγή της δημοσίευσης του το γράφει.


‘’Σύμφωνα με τον Παγκόσμιο Οργανισμό Υγείας (ΠΟΥ), το Κρατικό Γραφείο της ΠΟΥ για την Κίνα ενημερώθηκε για κρούσματα πνευμονίας άγνωστης αιτιολογίας στην πόλη Γουχάν, στην επαρχία Χουμπέι, στις 31 Δεκεμβρίου 2019 [1]. Ένας νέος coronavirus που ονομάζεται 2019-nCoV ανακοινώθηκε επίσημα ως αιτιώδης παράγοντας από τις Κινεζικές αρχές στις 7 Ιανουαρίου. Μια ιική αλληλουχία γονιδιώματος κυκλοφόρησε για άμεση υποστήριξη της δημόσιας υγείας μέσω του διαδικτυακού πόρου virological.org στις 10 Ιανουαρίου (Wuhan-Hu-1, αριθμός πρόσβασης GenBank MN908947 [2]), ακολουθούμενη από τέσσερα άλλα γονιδιώματα που κατατέθηκαν στις 12 Ιανουαρίου στον ιό Βάση δεδομένων ακολουθίας που επιμελήθηκε η Παγκόσμια Πρωτοβουλία για την κοινή χρήση όλων των δεδομένων γρίπης (GISAID).’’

''ανακοινώθηκε επίσημα ως αιτιώδης παράγοντας από τις κινεζικές αρχές στις 7 Ιανουαρίου.''

Βάσει ποιών επιστημονικών δεδομένων είναι αυτός ο ιός ο αιτιώδης παράγοντας, απο την ανακοίνωση των αρχών;;

Γιατί η πρώτη μελέτη των Peng Zhou,et al.που δημοσιεύτηκε στις 11-01-2020 στο συμπέρασμα τους καταλήγουν.

https://www.biorxiv.org/content/10.1101/2020.01.22.914952v2

''''Η μελέτη… παρέχει στοιχεία για μια συσχέτιση (association) μεταξύ της νόσου και της παρουσίας αυτού του ιού. Ωστόσο, εξακολουθούν να υπάρχουν πολλές επείγουσες ερωτήσεις για απαντήσεις. Χρειαζόμαστε περισσότερα κλινικά δεδομένα και δείγματα για να επιβεβαιώσουμε εάν αυτός ο ιός είναι πράγματι ο παράγοντας αιτιολογίας για αυτή την επιδημία."

Οχι μόνο δεν τον αναφέρουν ως causative agent (αιτιολογικός παράγοντας) αλλά ξεκάθαρα γράφουν ότι δεν γνωρίζουν σίγουρα εαν ο ιός είναι πράγματι η αιτιολογία αυτής της επιδημίας.


Μια άλλη μελέτη των Na Zhu et al. δημοσιεύεται στις 24-01-2020


''Αν και η μελέτη μας δεν πληροί τα αξιώματα του Koch, οι αναλύσεις μας παρέχουν στοιχεία που σχετίζονται (implicating) με το 2019-nCoV στο ξέσπασμα του Γουχάν."
Ούτε εδώ αναφέρουν για causative agent (αιτιολογικός παράγοντας).
Εκτός εαν το (association) και το implication το μετέφρασαν ο Drosten και ο ΠΟΥ σαν causative agent (αιτιολογικό παράγοντα).

Και ο Drosten και o ΠΟΥ αντί να στηριχτούν στα επιστημονικά δεδομένα στηρίχτηκαν στις δηλώσεις των Κινέζικων αρχών που δόθηκαν στις 7 Ιανουαρίου;;
Από τις 7 Ιανουαρίου και μετά δημοσιεύτηκαν 2 μελέτες και ο Drosten δημοσιεύει την δική του μελέτη στις 23-01-2020

Στη σελίδα 2, στην αριστερή στήλη αναφέρει:
‘’Στην παρούσα περίπτωση του 2019-nCoV, απομονώσεις ιών ή δείγματα από μολυσμένους ασθενείς δεν είναι ακόμη διαθέσιμα στη διεθνή κοινότητα και τις υπηρεσίες δημόσιας υγείας. Αναφέρουμε εδώ σχετικά με τη θέσπιση και την επικύρωση ενός διαγνωστικού τεστ για τον έλεγχο του 2019-nCoV και την επιβεβαίωση ότι αναπτύχθηκε απουσία διαθέσιμων απομονωμένων ιών ή πρωτότυπων δειγμάτων ασθενών. Ο σχεδιασμός και η επικύρωση κατέστη δυνατή χάρη στη στενή γενετική σχέση με το SARS-CoV από το 2003 και υποστηρίχθηκε από τη χρήση τεχνολογίας συνθετικών νουκλεϊκών οξέων.''

Δημοσίευση Zhou : Ομολογία ακολουθίας
''Είναι σχεδόν πανομοιότυπoι μεταξύ τους και μοιράζονται 79,5% ταυτότητα ακολουθίας με τον SARS-CoV. "
Αλλά και οι άνθρωποι μοιράζονται γενετική ακολουθία με τους χιμπατζήδες.
Οι άνθρωποι μοιράζονται 96% ομολογία γενετικής αλληλουχίας
με τους χιμπατζήδες!

ΑΠΟΥΣΙΑ ΔΙΑΘΕΣΙΜΩΝ ΔΕΙΓΜΑΤΩΝ ΑΣΘΕΝΩΝ. ΚΑΙ ΠΟΙΟ ΕΙΝΑΙ ΤΟ GOLD STANDAR;; 
Γιατί τόση βιασύνη να προαποφασίσουμε τον αιτιολογικό παράγοντα χωρίς επιστημονικά δεδομένα και να βιαστούμε να βγάλουμε τέστ χωρίς να έχει δημοσιευτεί το γονιδίωμα και χωρίς να έχουμε δείγματα ασθενών και απομονωμένο ιο;;
Και οι δηλώσεις του ίδιου του κυρίου Drosten για το τέστ που εδω και πάνω απο 10 χρόνια κατασκευάζει.Το 2014 δηλώνει για το τέστ.

Η ακόλουθη δήλωση θα πρέπει να διαμορφωθεί δεδομένου ότι η δήλωσή του από το 2014 είναι εξαιρετικά λογική, ενώ σήμερα ισχυρίζεται ότι θα δοκιμάσει όλους (παρόλο που είναι επίσης αντιφατικός σε αυτή τη συγκεκριμένη περίπτωση). Τελικά τι ισχύει;;

Ποιά είναι η φερεγγυότητα του τέστ όταν σε δημοσίευση σε έλεγχο από ομότιμους που έγινε από τους Dahdouh et al σταλμένη και στην Eurosurveillance, το συμπέρασμα των ειδικών και ελεγκτών είναι ‘’ Λείπουν θετικά στοιχεία ελέγχου για επικύρωση δοκιμής PCR’’
Δεν υπάρχει gold standard.
Aναφέρουν οι ελεγκτές.
''Το τεστ μπορεί να πιστοποιήσει ότι είσαι άνθρωπος, όχι αν έχεις τον ιό''

Σε δημοσίευση των Dahdouh et al  οι συγγραφείς ρωτούν.
Στοχεύουν οι εξειδικευμένοι εκκινητές της RT-PCR για τον Sars-cov 2 ανθρώπινο γονιδίωμα;
Και εάν θέλετε να πιστοποιήσετε τα γραφόμενα, υπάρχουν στην αξιολόγηση ομοτίμων στο  CORMAN-DROSTEN REVIEW REPORT στην διεύθυνση https://cormandrostenreview.com/addendum/

Dahdouh et al  
C. Λείπουν θετικά στοιχεία ελέγχου για επικύρωση της δοκιμής PCR
D. In silico analysis / Ομολογία Primer με το ανθρώπινου DNA
Οι Dahdouh et al σε επιστολή προς τον συντάκτη του J. Infect., επισημένουν τη διακύμανση Ct που παρατηρείται στους εσωτερικούς ελέγχους που στοχεύουν ανθρώπινο DNA ταυτόχρονα με την ανίχνευση SARS-CoV-2 (Σχήμα 21).
Συμπερασματικά, επισημαίνουν:
"Πρέπει να γίνει πλήρης χαρακτηρισμός των γραμμικών περιοχών και βαθμονόμησης χρησιμοποιώντας πρότυπα για κάθε διαφορετικό σχεδιασμό στόχου και εκκινητή / ανιχνευτή." [25]
Η βαθμονόμηση και τα εσωτερικά στοιχεία ελέγχου λείπουν εντελώς από τους Corman et al. 

Σχεδιασμός PCR.
Δεδομένων των πολυάριθμων παραδειγμάτων που παρουσιάστηκαν για την παραγωγή FP και FN με τους γρήγορα σχεδιασμένους εκκινητές Corman-Drosten, υπάρχει μια τελική πνευματική πρόκληση την οποία παρουσιάζει αυτή η ανάλυση. Σε αντίθεση με τους περισσότερους άλλους προσδιορισμούς SARPC-CoV-2 qPCR, ο προσδιορισμός Corman-Drosten στερείται εσωτερικού ελέγχου. Η έλλειψη τέτοιων ελέγχων καθιστά οποιαδήποτε μέτρηση με τον προσδιορισμό εκτεθειμένο σε μια σημαντική πηγή μεταβλητότητας (4 logs) καθώς δεν υπάρχει αναφορά για την ερμηνεία των ιικών φορτίων, τα οποία δεν μπορούν να προσδιοριστούν από τις τιμές Ct χωρίς τέτοια αναφορά σε έναν εσωτερικό έλεγχο.''
Στην δημοσίευση των Dahdouh et al. επισημαίνουν ότι η Ct  διακύμανση που εμφανίζεται στους εσωτερικούς ελέγχους, στοχεύει ανθρώπινο DNA ταυτόχρονα με την ανίχνευση SARS-CoV-2 (Εικόνα 23).
Dahdouh et al.
''Έχουμε πραγματοποιήσει επιπρόσθετες αναλύσεις για να αντιμετωπίσουμε τις ανησυχίες που εκφράστηκαν σχετικά με τους εκκινητές Charité (Drosten)  και την ομολογία τους με το ανθρώπινο DNA.

Έχουμε συμπεριλάβει μια ανάλυση BLAST των εκκινητών Charité κατά του Ανθρώπινου Γονιδιώματος (GRCh38.p13).
Υπάρχουν αρκετές σημαντικές ομολογίες, αλλά καμία που να  έχει τόσο εκκινητή όσο και ανιχνευτές σε κοντινή απόσταση. Αν και αυτές οι ομολογίες εκτός στόχου δεν είναι καταστροφικές για την απόδοση της ανάλυσης, αποδεικνύουν την έλλειψη silico analysis που έγινε πριν από τη δημοσίευση και μπορεί να διαδραματίσουν ρόλο στην in-vitro σύνθεση περισσότερων από 3 διαφορετικών πρωταρχικών άκρων εκκινητών κατά τη διάρκεια του βήματος cold (55C) reverse transcription της RT-qPCR. Το αρχείο εξόδου BLAST είναι διαθέσιμο για λήψη στην ενότητα αναφορών [30].
Με την έλλειψη κιτ καθαρισμού RNA το 2020, πολλά εργαστήρια χρησιμοποιούν τροποποιημένα πρωτόκολλα καθαρισμού που παραλείπουν το βήμα DNAse αφήνοντας έτσι το ανθρώπινο DNA ως βιώσιμο στόχο εκκινητών (Σχήμα 28) [32].

Figure 29 shows the 18bp 3 prime homology found in the RdRp Reverse primer to human chromosome 18.

Ας δούμε εάν το εξειδικευμένο τεστ ενισχύει ακόμη και σκέτο και το νερό.

https://pubs.acs.org/doi/10.1021/acsinfecdis.0c00464

 Οι Jung et al. Περαιτέρω απόδειξαν ότι αυτοί οι εκκινητές έχουν μειωμένη ευαισθησία όπως αναφέρεται από τους Muenchhoff et al. Ψευδώς αρνητικά και ψευδώς θετικά παράγονται με τον σχεδιασμό εκκινητή Corman-Drosten.

 ''Οι ασυνεχείς εκκινητές όχι μόνο αποτυγχάνουν να ενισχύσουν στόχους σε ορισμένα δείγματα, αλλά ενισχύουν επίσης μη ειδικές αλληλουχίες σε άλλα δείγματα τα οποία δεν πρέπει να ενισχύσουν. Σε αυτήν την περίπτωση ενισχύουν το νερό (NTC). Οι συγγραφείς καταδεικνύουν ότι το Charité RdRp PCR δημιουργεί θετικά σήματα στο νερό αλλά σε μικρότερο βαθμό από τους συνδυασμούς εκκινητών CDC ΗΠΑ και Κίνας (βλέπε * στις γραμμές 1,3 και 5 στο Σχήμα 6β). Ωστόσο, ο σχηματισμός διμερούς εκκινητή φαίνεται στην εικόνα πηκτής με το US CDC (γραμμή 1) και το ζεύγος εκκινητών Charite RdRp (γραμμή 5) (βέλος), (βλέπε τροποποιημένη Εικόνα 7).


‘’Promiscuous primers not only fail to amplify targets in some samples, they also amplify non-specific sequences in other samples which they should not amplify. In this case they amplify water (NTC). The authors demonstrate the Charité RdRp PCR generate positive water signals but to a lesser extent than the US and China CDC primer combinations (see * in lines 1,3 and 5 in Figure 6b). However, primer dimer formation is seen in the gel image with the US CDC (line 1) and the Charite RdRp (line 5) primer pair (arrow), (see modified Figure7).

Συμπέρασμα:

Το RdRp PCR ( μιλάμε πάντα για τους εξειδικευμένους εκκινητές της PCR ) από τους Drosten-Corman et al. Η δημοσίευση παράγει λιγότερο ψευδώς θετική ενίσχυση από το CDC των ΗΠΑ και της Κίνας CDR N1 και N, ωστόσο παράγει μια πολύ προβληματική ενίσχυση του «σκέτου νερού», το οποίο είναι μια σαφής απαγόρευση για μια αντίδραση PCR που προορίζεται για διαγνωστική χρήση.

Conclusion:

The RdRp PCR from the Corman et al. publication produces less false positive amplification than the US and China CDC N1 and N PCR, however it still produces a very problematic amplification of “water only” which is a clear no-go for a PCR reaction intended for diagnostic use.

Etievant et al.  

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7355678/

Αυτή η αναφορά δείχνει επίσης κακά αποτελέσματα με τον προσδιορισμό γονιδίου Charité E και το αποδίδει σε μόλυνση εκκινητών και διμερή εκκινητή.Η δημοσίευση των  Etievant et αl. επισημαίνει τον διμερισμό που μπορεί να συμβεί μεταξύ των προσδιορισμών γονιδίων E και RdRp:

''Οι δοκιμές E Charité και N2 US CDC ήταν θετικές για όλα τα δείγματα, συμπεριλαμβανομένων των αρνητικών δειγμάτων και των αρνητικών μαρτύρων (νερό). Αυτά τα ψευδώς θετικά αποτελέσματα διερευνήθηκαν (λεπτομέρειες παρακάτω)

Συμπέρασμα:

Το ζεύγος E-primer των Corman et al. παράγει ψευδή αρνητικά είτε λόγω μόλυνσης είτε λόγω μη ειδικής ενίσχυσης.

Pfefferle et al.

https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.9.2000152

Πρέπει να σημειωθεί ότι από τη φύση του ως δοκιμή διαλογής που στοχεύει μόνο ένα μόνο ιικό γονίδιο, τα θετικά αποτελέσματα πρέπει πάντα να επιβεβαιώνονται με ανεξάρτητη PCR όπως συνιστάται." [42]

Τι μας λένε οι ελεγκτές;;

''Μια από τις αξιολογήσεις που περνούν οι μέθοδοι PCR, σχετίζεται με την εξειδίκευση τους, η οποία αρχικά καθορίζεται «in silico», ( που αποδεικνύεται ότι δεν έγινε) δηλαδή μέσω ανάλυσης βιοπληροφορικής της ειδικότητας των εκκινητών, που συμπληρώνεται από μια πειραματική προσέγγιση.''

Ακριβώς πολύ σωστά το τοποθετείτε, επειδή  μέσα σε μία ημέρα αξιολόγησης του εγγράφου και της έγκρισής του δεν έγινε η πειραματική προσέγγιση για αυτό και τα τόσα bias και λάθη.

Το έγγραφο Drosten υποβλήθηκε στο περιοδικό της Eurosurveillance επίσημα στις 21/01/2020, έγινε δεκτό στις 22/01/2020  και έγινε η αξιολόγηση απο ομοτίμους (συνήθως η αξιολόγηση διαρκεί τουλάχιστον 2 εβδομάδες έως και μήνες) εγκρίθηκε και δημοσιεύθηκε στις 23/01/2020 μέσα σε μία μέρα.  

Μπορεί κάποιος να υποστηρίξει ότι ο Drosten ως μέλος του συντακτικού συμβουλίου της Eurosurveillance γνώριζε την αρχισυντάκτρια την Δρ Ines Steffens,είχε καλές σχέσεις και έτσι επιταχύνθηκε η διαδικασία από 2 εβδομάδες και μήνες που μπορεί να κρατήσει η αξιολόγηση, έγινε σχεδόν σε 2 ημερες. 

Χωρίς προηγούμενο: Μέσα σε 2 -3 ημέρες, ο κ. Drosten, μαζί με τον ιδιοκτήτη της TIB Molbiol τον κύριο Olfert Landt (κατασκευαστής για δοκιμές τεστ κίτ δοκιμών PCR με έδρα στο Βερολίνο), ο οποίος ήταν και ο συν συγγραφέας της δημοσίευσης Corman-Drosten αναπτύσσει το τέλειο τεστ για έναν υποτιθέμενο εντελώς νέο ιό που ο κόσμος δεν έχει δει ακόμα!

Ήδη στις 10 Ιανουαρίου, 3 ημέρες μετά την ανακοίνωση και δήλωση των Κινέζικων αρχών ότι ο αιτιολογικός παράγοντας της πανδημίας ήταν αυτός ο ιός και ενώ οι επιστημονικές μελέτες ανέγραφαν σαφώς ότι ''Χρειαζόμαστε περισσότερα κλινικά δεδομένα και δείγματα για να επιβεβαιώσουμε εάν αυτός ο ιός είναι πράγματι ο παράγοντας αιτιολογίας για αυτή την επιδημία.", η εταιρεία Landt, TIB-Molbiol, είχε ένα πλήρως λειτουργικό κιτ δοκιμής έτοιμο και άρχισε να το στέλνει σε όλο τον κόσμο. Φοβερός αυτός, ο κ. Landt. Ταχύτατος!

22  Ιανουαρίου ανέβηκε στο διαδίκτυο η πρώτη ολοκληρωμένη αλληλουχία του SARS-CoV-2.

21  Ιανουαρίου μια ημέρα πριν είχε σταλεἰ το έγγραφο με το τεστ και τους εκκινητές για δημοσίευση, βασιζόμενοι στα social media.

10  Γενάρη η εταιρεία TIB-Molbiol στέλνει παραγγελίες σε όλο τον κόσμο.

https://translate.google.com/translate?sl=auto&tl=en&u=https://www.tagesspiegel.de/berlin/tib-molbiol-berliner-firma-produziert-coronavirus-tests-fuer-die-ganze-welt/25602142.html

Κατανοητά τα παραπάνω, αλλά όχι παραδεκτά γιατί εάν πράγματι είχε γίνει αυτή η έρμη πειραματική προσέγγιση που φωνάζουμε θα είχαν αποφευχθεί όλα τα παραπάνω.

Συνεχίζουν οι ελεγκτές

''Το πρόγραμμα BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) στο οποίο λανθασμένα αναφέρεται η κ. Μαριάννα Ευαγγέλου δε χρησιμοποιείται για τον έλεγχο των εκκινητών αλλά για σύγκριση αλληλουχιών.’’

ΔΗΛΑΔΗ ΟΙ ΕΚΙΝΝΗΤΕΣ ΔΕΝ ΕΙΝΑΙ ΑΚΟΛΟΥΘΙΕΣ;;;;

Και οι επιστήμονες Dahdouh et al.που δημοσίευσαν το αρχείο BLAST και αυτοί παραπληροφορούν;;

ΕΥΧΑΡΙΣΤΩ ΓΙΑ ΤΟ ΒΙΝΤΕΟ ΘΑ ΤΟ ΧΡΗΣΙΜΟΠΟΙΗΣΩ ΓΙΑ ΕΝΗΜΕΡΩΣΗ ΤΟΥ ΚΟΣΜΟΥ ΕΑΝ ΔΕΝ ΕΧΕΤΕ ΑΝΤΙΡΗΣΗ, ΑΛΛΑ ΘΑ ΗΘΕΛΑ ΝΑ ΚΑΝΕΤΕ ΚΑΙ ΤΟ ΔΕΥΤΕΡΟ ΜΕΡΟΣ.

Να βάλετε εκτος από το Ν1 και τις παρακάτω ακολουθίες, ὀπως και τις ακολουθίες των Dahdouh et al. που ανέφερα πιο πάνω, για να γίνει πιο ενημερωμένο το βίντεο.

''Για «In silico» σχεδιασμό και πρόβλεψη της αποτελεσματικότητας και ειδικότητας της δέσμευσης των εκκινητών χρησιμοποιείται το Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Παρόλα αυτά δεν επαρκεί μόνο ένας έλεγχος στον υπολογιστή, οπότε πάντα είναι απαραίτητο να γίνεται μια πειραματική σύγκριση της ανάλυσης για ευαισθησία και ειδικότητα.’’

Ακριβώς πιο πάνω οι Dahdouh et al σας παρέχουν το αρχείο BLAST για έλεγχο, όσο για την δεύτερη διεύθυνση που μας δίνουν οι ελεγκτές, είναι για σχεδιασμό εκκινητών, για να δούμε ποιους εκκινητές θα σχεδιάσουμε και όπως σωστά λένε πάντα πρέπει να κάνουμε πειραματική προσέγγιση και έλεγχο που δεν έγινε.

Πάμε στην έρευνα στο στο BLAST από άλλους επιστήμονες.

Πρωτόκολλο CDC της Κίνας: χρησιμοποιεί γονίδια ORF1ab και N ως στόχο.

Πρωτόκολλο του Ινστιτούτου Pasteur (Γαλλία): χρησιμοποιεί δύο θραύσματα του RdRP (το οποίο υποτίθεται ότι είναι ειδικό για το SARS.CoV-2).

Πρωτόκολλο CDC των Ηνωμένων Πολιτειών: χρησιμοποιεί τρία τμήματα του γονιδίου Ν.

Πρωτόκολλο του Εθνικού Ινστιτούτου Λοιμωδών Νοσημάτων της Ιαπωνίας: είναι το μόνο που έχει ως στόχο το γονίδιο S μαζί με άλλα γονίδια που υποτίθεται ότι μοιράζονται με άλλους κοροναϊούς.

Πρωτόκολλο Charite (Γερμανία): χρησιμοποιεί τα γονίδια E, N και RdRP.

Πρωτόκολλο Πανεπιστημίου του Χονγκ Κονγκ: χρησιμοποιεί γονίδια ORF1b-nsp14 και N.

Πρωτόκολλο του Εθνικού Ινστιτούτου Υγείας της Ταϊλάνδης: χρησιμοποιεί το γονίδιο Ν.

Ας δούμε λεπτομερώς τη διαδικασία λαμβάνοντας ως παράδειγμα τους εκκινητές του Γαλλικού πρωτοκόλλου RdRP. 

Όταν βρισκόμασταν στον ιστότοπο BLAST, επιλέξαμε τα μικρόβια για αναζήτηση στις βάσεις δεδομένων του μικροβιακού γονιδιώματος και μετακινηθήκαμε στην επόμενη σελίδα. 

Στη συνέχεια εμφανίστηκε μια φόρμα στην οποία βάλαμε την ακολουθία του εμπρόσθιου εκκινητή του Γαλλικού πρωτοκόλλου - που είναι ATGAGCTTAGTCCTGTG-, επιλέξαμε την επιλογή Εξαιρετικά παρόμοιες ακολουθίες και πιέσαμε το πλήκτρο BLAST. Λίγα δευτερόλεπτα αργότερα εμφανίστηκαν τα αποτελέσματα - πήραμε ένα στιγμιότυπο οθόνης -και μας εμφανίστηκαν 100 μικροβιακές ακολουθίες- ιδιαίτερα βακτηρίων και αρχαίων - με σύμπτωση της ακολουθίας μεταξύ από 77% έως 100% και με ποσοστό ταυτότητας 100%. 

Στη συνέχεια επιστρέψαμε στην αρχική σελίδα και την δεύτερη φορά επιλέξαμε τον άνθρωπο για αναζήτηση του ανθρώπινου γονιδιώματος, επαναλάβαμε την ίδια λειτουργία και μετά από λίγα δευτερόλεπτα εμφανίστηκε το αποτέλεσμα που καταγράψαμε ξανά. Και αποδεικνύεται ότι η αλληλουχία που εισήχθη συμπίπτει με 74 αλληλουχίες του ανθρώπινου γονιδιώματος, με σύμπτωση από 66% έως 100% και ποσοστό ταυτοποίησης 100%.

Και αυτό δείχνει ότι η ακολουθία αυτού του αρχικού εκκινητή PCR που υποτίθεται ότι είναι ειδικός για το SARS-CoV-2 αντιστοιχεί στην πραγματικότητα σε 74 θραύσματα του ανθρώπινου γονιδιώματος και εκατό μικροβιακά θραύσματα επίσης!

Στη συνέχεια, αποφασίσαμε να επαναλάβουμε τη λειτουργία, αλλά με τον τελικό ή αντίστροφο εκκινητή - που είναι CTCCCTTTGTGTGTGT - και τα αποτελέσματα ήταν παρόμοια.

Δεδομένου ότι αυτές ήταν πολύ μικρές ακολουθίες - περίπου είκοσι γενετικά γράμματα ή νουκλεοτίδια - αποφασίσαμε να δοκιμάσουμε ξανά αλλά με την ακολουθία στόχο που ορίζεται από αυτούς τους δύο εκκινητές, δηλαδή την ακολουθία του υποτιθέμενου γονιδιώματος SARS-CoV-2 που βρίσκεται μεταξύ του αρχικού εκκινητή και του τελικού εκκινητή.

Προφανώς, για αυτό χρειαζόμασταν την ακολουθία που ισχυρίζεται επίσημα ότι είναι το "γονιδίωμα SARS-CoV-2" και παρόλο που χιλιάδες εργαστήρια ισχυρίζονται ότι το έχουν απομονώσει και αλληλουχήσει - έναν ψεύτικο ισχυρισμό όπως έχουμε εξηγήσει σε προηγούμενες εκθέσεις - αποφασίσαμε να μεταβούμε στον ιστότοπο του Εθνικού Κέντρου Βιοτεχνολογίας: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903.

Μόλις φτάσαμε εκεί, εντοπίσαμε την ''αλληλουχία στόχο'', ένα τμήμα 108 νουκλεοτιδίων που βρίσκεται μεταξύ των θέσεων 12.690 και 12.797 του ''γονιδιώματος'', το οποίο είναι αυτό:

ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG.

Με αυτό επαναλάβαμε τα βήματα που περιγράφηκαν προηγουμένως και τα αποτελέσματα ήταν και πάλι εκπληκτικά αφού εμφανίστηκαν και πάλι 100 μικροβιακές ακολουθίες με ποσοστό αντιστοιχίας 100% και 4 αλληλουχίες του ανθρώπινου γονιδιώματος με ποσοστό ταυτότητας μεταξύ 83% και 95%. Οι ομοιομορφίες ήταν επομένως χαμηλότερες, αλλά το σημαντικό είναι ότι συνεχίζουμε να βρίσκουμε τμήματα της υποτιθέμενης ''ακολουθίας στόχου'' του SARS-CoV-2 τόσο σε μικρόβια όσο και στο δικό μας γονιδίωμα.

Πραγματικά έκπληκτοι κάναμε ένα ακόμη βήμα και δοκιμάσαμε με το γονίδιο που θεωρήθηκε εκείνη την εποχή ως το πιο ειδικό του SARS-CoV-2, το γονίδιο Ε που υποτίθεται ότι δημιουργεί τις πρωτεΐνες φακέλου και βρίσκεται μεταξύ των θέσεων 26.245 και 26.472:

ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTACTGTTTGTTTTTTTTGTTTGTTGTTGTGTTGTGTGTGTGTTCTGRT

Επαναλάβαμε με αυτό τα βήματα που έχουν ήδη περιγραφεί και το αποτέλεσμα ήταν ακόμη πιο εκπληκτικό, διότι παρά το μήκος του εμφανίστηκαν εκατοντάδες μικροβιακές ακολουθίες με ποσοστό ταυτότητας 100% και 10 αλληλουχίες του ανθρώπινου γονιδιώματος με ποσοστό ταυτότητας μεταξύ 80% και 100% . 

Και παρόμοια αποτελέσματα ελήφθησαν με ένα θραύσμα που επιλέχθηκε τυχαία και με το γονίδιο Ν που λένε ότι αντιστοιχεί στις πρωτεΐνες του νουκλεοκαψιδίου SARS-CoV-2.

Τελικά αποφασίσαμε να δοκιμάσουμε με το γονίδιο S που λέγεται ότι δημιουργεί τις δομικές πρωτεΐνες ''ακίδων'' που είναι το κλειδί για την είσοδο στο κύτταρο και στη συνέχεια θεωρήθηκε ότι είναι το πιο ειδικό γονίδιο SARS-CoV-2.

Δεδομένου ότι είναι ένα γονίδιο του οποίου η αλληλουχία είναι πολύ μεγαλύτερη - 3821 νουκλεοτίδια μεταξύ των θέσεων 21.563 και 25.384 - δοκιμάσαμε με δύο θραύσματα που επιλέχθηκαν τυχαία μέσα σε αυτό το γονίδιο και το πρώτο-TTGGCAAAATTCAAGACTCACTTTC- 

Είχε ως αποτέλεσμα άλλες εκατοντάδες μικροβιακές αλληλουχίες και 93 αλληλουχίες του ανθρώπινου γονιδιώματος και το δεύτερο - CTTGCTGCTACTAAATGCAGAGTGT - 100 μικροβιακές αλληλουχίες και 90 του ανθρώπινου γονιδιώματος.

Τελικά αποφασίσαμε να δοκιμάσουμε με τους εκκινητές του Πρωτοκόλλου της Ιαπωνίας, το μόνο που περιλαμβάνει τις αλληλουχίες στόχου του γονιδίου S και, ο αναγνώστης θα είχε ήδη μαντέψει, τα αποτελέσματα ήταν και πάλι παρόμοια: 100 μικροβιακές αλληλουχίες και 93 αλληλουχίες του ανθρώπινου γονιδιώματος με ποσοστό ταυτότητας μεταξύ 94,12% και 100%!

ΣΥΜΠΕΡΑΣΜΑΤΑ

Η συνέπεια όλων αυτών που μόλις εξηγήσαμε είναι σαφής και άμεση: ΔΕΝ ΥΠΑΡΧΕΙ ΚΑΜΙΑ ΕΓΚΥΡΗ ΔΟΚΙΜΗ ΓΙΑ ΑΝΙΧΝΕΥΣΗ ΤΟΥ SARS-COV-2, ούτε δοκιμές αντισωμάτων ή αντιγόνων ούτε RT-PCR.

Συνεχίζουν οι ελεγκτές, 

''Οι Zhang και συνεργάτες ήταν οι πρώτοι που προσδιορίσαν τη γονιδιωματική αλληλουχία πλήρους μήκους του ιού SARS-CoV-2. Στις 26 Δεκεμβρίου 2019, έξι ημέρες μετά τον εντοπισμό της νόσου, ένας 41χρονος άνδρας με πυρετό, μη παραγωγικό βήχα, πόνο, και αδυναμία εισήχθη στο Κεντρικό Νοσοκομείο της Γουχάν. Συλλέχθηκε υγρό βρογχοκυψελιδικής πλύσης (BALF) για να εκτελεστεί βαθιά μετα-μεταγραφική αλληλούχιση.'' 

ΒΑΘΙΑ ΜΕΤΑΓΡΑΦΙΚΗ ΑΛΛΗΛΟΥΧΙΣΗ, ΔΕΝ ΑΝΑΦΕΡΕΙ ΚΑΘΑΡΙΣΜΟ, ΑΛΛΑ ΤΟ ΠΡΟΣΠΕΡΝΑΜΕ. 

ΠΟΣΟ ΣΙΓΟΥΡΟΙ ΕΙΜΑΣΤΕ ΧΩΡΙΣ ΚΑΘΑΡΙΣΜΟ ΟΤΙ ΠΡΑΓΜΑΤΙ ΑΥΤΕΣ ΟΙ ΑΚΟΛΟΥΘΙΕΣ ΠΟΥ ΠΑΡΘΗΚΑΝ ΑΠΟ ΤΟ ΥΠΕΡΚΕΙΜΕΝΟ, ΧΩΡΙΣ ΦΙΛΤΡΑΡΙΣΜΑ ΑΝΗΚΟΥΝ ΣΤΟΝ SARS COV 2;;

''Την 1η Ιανουαρίου 2020, οι Corman και συνεργάτες (από την ομάδα του Dr Christian Drosten) χρησιμοποίησαν τη στενή συσχέτιση μεταξύ των γονιδιωμάτων SARS-CoV-2 και SARS για να συνθέσουν τεχνητά την ακολουθία 2019-nCoV’’

Γιατί δεν είχαν δείγματα, δεν είχαν απομονωμένο ιό.

ΑΦΟΥ ΣΤΗΝ 1 ΙΑΝΟΥΑΡΙΟΥ ΔΕΝ ΕΙΧΕ ΔΗΜΟΣΙΕΥΘΕΙ ΤΟ ΓΟΝΙΔΙΩΜΑ, ΔΕΝ ΕΙΧΕ ΠΑΕΙ ΑΚΟΜΗ Η ΚΙΝΕΖΙΚΗ ΟΜΑΔΑ ΣΤΗ ΓΟΥΧΑΝ.

ΠΩΣ ΗΞΕΡΕ Ο ΝΤΡΟΣΤΕΝ ΤΟ ΓΟΝΙΔΙΩΜΑ. ΕΔΩ ΤΕΧΝΗΕΝΤΩΣ ΔΕΝ ΑΝΑΦΕΡΕΤΕ, ΑΥΤΑ ΠΟΥ Ο ΙΔΙΟΣ ΓΡΑΦΕΙ ΣΤΗΝ ΔΗΜΟΣΙΕΥΣΗ ΤΟΥ OTI BAΣΙΣΤΗΚΕ ΣΕ ΑΝΑΦΟΡΕΣ ΑΠΟ ΤΑ  social media.

''Πριν από τη δημοσίευση αλληλουχιών ιών από περιπτώσεις 2019-nCoV, βασιζόμενοι σε αναφορές κοινωνικών μέσων που ανακοινώνουν την ανίχνευση ενός ιού τύπου SARS.'' Υποθέσαμε λοιπόν ότι ένας CoV που σχετίζεται με το SARS εμπλέκεται στο ξέσπασμα.'' Πραγματοποιήσαμε λήψη όλων των ολοκληρωμένων και μερικών (εάν> 400 nt) αλληλουχιών ιών που σχετίζονται με το SARS και είναι διαθέσιμες στη GenBank έως την 1η Ιανουαρίου 2020.''

Παρακάτω στην δημοσίευση.

''και να δημιουργήσουν μια πειραματική διαδικασία ανίχνευσης απουσία απομόνωσης ιού. (ΑΚΡΙΒΩΣ ΑΠΟΥΣΙΑ ΑΠΟΜΟΝΩΣΗΣ ΙΟΥ, το γράφετε καθαρά)  Συγκεκριμένα πραγματοποιήσαν λήψη όλων των ολοκληρωμένων και μερικών (εάν> 400 nt) αλληλουχιών από τον άγνωστο τότε SARS, διαθέσιμες στη GenBank έως την 1η Ιανουαρίου 2020. Η λίστα (n = 729 καταχωρήσεις) ελέγχθηκε χειροκίνητα και αφαιρέθηκε ότι δε σχετιζεται με τον ιό, με αποτέλεσμα να προκύψει μια τελική λίστα 375 αλληλουχιών.’’

ΕΔΩ ΝΑ ΔΕΙΤΕ ΛΙΓΟ ΠΩΣ ΓΙΝΕΤΑΙ Η ΔΙΑΔΙΚΑΣΙΑ ΑΦΑΙΡΕΣΗΣ ΚΑΙ ΝΑ ΤΑ ΞΑΝΑΠΟΥΜΕ ΓΙΑΤΙ Η ΑΠΑΝΤΗΣΗ ΘΑ ΓΙΝΕΙ ΒΙΒΛΙΟ.

''Στις 22 του Γενάρη ανέβηκε στο διαδίκτυο η πρώτη ολοκληρωμένη αλληλουχία του SARS-CoV-2 στο virological.org και National Center for Biotechnology Information (NCBI). Με την κυκλοφορία της πρώτης ακολουθίας 2019-nCoV έγινε επιβεβαίωση και βελτίωση των εκκινητων.'' 

Πότε, πού και πώς;;

( ΠΟΤΕ ΕΓΙΝΕ Η ΕΠΙΒΕΒΑΙΩΣΗ ΚΑΙ Η ΒΕΛΤΙΩΣΗ, ΤΟ ΧΑΡΤΙ ΕΙΧΕ ΦΥΓΕΙ) ''ενώ όπως προείπαμε ο έλεγχος των εκκινητων είναι συνεχής.’’

ΑΚΡΙΒΩΣ ΑΝΑΓΚΑΣΤΗΚAN ΝΑ ΑΛΛΑΞOYN ΑΡΚΕΤΑ, ΑΛΛΑ ΤΑ ΒΑΣΙΚΑ ΛΑΘΗ ΠΑΡΑΜΕΝΟΥΝ.

Αφού σύμφωνα με τα λεγόμενα σας, η πρώτη ολοκληρωμένη ακολουθία ανέβηκε στις 22 Γενάρη και ο Drosten είχε ήδη καταθέσει την δημοσίευση του με όλους τους εκκινητές στο Eurosurveillance στις 21 Γενάρη μια ημέρα πριν δημοσιευτεί  η πρώτη πλήρης ακολουθία και στις 23 μέσα σε μια μέρα, οι ομότιμοι το έλεγξαν και βρήκαν πολύ καλούς τους εκκινητές και το δημοσίευσαν πότε πρόλαβε και έγινε η πειραματική προσέγγιση και ο έλεγχος των εκκινητών;;

Τα τέστ είχαν ήδη φτάσει στο Χονγκ Κονγκ από τις 10 Γενάρη και έως το τέλος του Γενάρη σε 60 χώρες.

Συνεχίζουν οι ελεγκτές.

''Ακόμα κι αν η ανίχνευση μόνο του γονιδίου Ε δεν συνιστάται από το Ευρωπαϊκό Κέντρο Πρόληψης και Ελέγχου Νόσων (ECDC) λόγω προβλημάτων εξειδίκευσης και της ευπάθειας του σε δειγματοληπτική μόλυνση, συνιστάται ωστόσο η χρήση του γονιδίου Ε ως στόχος, μαζί με το γονίδιο RdRP για επιβεβαίωση. Η ανίχνευση του γονιδίου Ε μπορεί επίσης να συνδυαστεί με ανίχνευση του γονιδίου Ν.'' 

Μάλιστα και η οδηγία του ΠΟΥ την οποία ωφείλουν να ακολουθούν όλες οι συμβαλλόμενες χώρες στις 4 Απριλίου;;

04/03/2020

Άλλαξε η διάταξη των αποτελεσμάτων PCR SARS-CoV2

''Από τώρα και στο εξής θα παράγουμε μόνο το αποτέλεσμα θετικό ή αρνητικό στα ευρήματά μας.
Μέχρι στιγμής, ανάλογα με τη δοκιμή που χρησιμοποιήσατε, έχετε δύο αποτελέσματα.
Εάν το δείγμα αναλύθηκε χρησιμοποιώντας τη μέθοδο Roche, έχουμε δώσει τα αποτελέσματα μέτρησης και για τις δύο αλληλουχίες στόχου του PCR (ORF1 και Ε γονίδιο) ξεχωριστά. Το γονίδιο ORF1 είναι ειδικό για SARS-CoV-2, ενώ το γονίδιο Ε βρίσκεται επίσης σε άλλους κοροναϊούς. Έχουμε ήδη αξιολογήσει τις περιπτώσεις στις οποίες μόνο το γονίδιο ORF ενισχύθηκε ως θετικό. Λίγες περιπτώσεις με ένα απομονωμένο θετικό Ε γονίδιο ταξινομήθηκαν ως αμφισβητήσιμες και ως εκ τούτου επανειλημμένα οδήγησαν σε ερωτήσεις και προβλήματα σχετικά με την περαιτέρω αντιμετώπιση των προσβεβλημένων ασθενών. Λαμβάνοντας υπόψη την επιδημιολογική κατάσταση και το συνολικό αυξημένο θετικό ποσοστό, ακολουθούμε τώρα τη σύσταση του ΠΟΥ και θα αναφέρουμε ένα αποτέλεσμα ως «θετικό» εάν μόνο το γονίδιο Ε έχει ενισχυθεί. Για απλοποίηση της διάγνωσης, Επομένως, μόνο ένα συνολικό αποτέλεσμα (θετικό ή αρνητικό) θα εμφανιστεί στο μέλλον. Το αποτέλεσμα είναι θετικό εάν τουλάχιστον μία από τις δύο αλληλουχίες στόχους του SARS-CoV-2 έχει ανιχνευτεί στο υλικό επιχρίσματος.
Εάν το δείγμα αναλύθηκε χρησιμοποιώντας μεθόδους από rBiopharm ή TibMolbiol, είχαμε προηγουμένως πραγματοποιήσει ξεχωριστές εξετάσεις ελέγχου και επιβεβαίωσης. Ανάλογη με τη διαδικασία που περιγράφεται παραπάνω, λόγω της υψηλής θετικής προγνωστικής τιμής με την αύξηση του επιπολασμού COVID-19, περιοριζόμαστε στην προηγούμενη δοκιμή διαλογής που στοχεύει το γονίδιο Ε.''

Αρα απο τον Απρίλιο και μετά εαν και μόνο το γονίδιο Ε βρεθεί θετικό, που όπως οι ίδιοι αναφέρουν '' το γονίδιο Ε βρίσκεται επίσης σε άλλους κοροναϊούς'' τότε ο ασθενής είναι θετικός στον Sars-Cov 2.

Δεν είναι μόνο οι επιστήμονες, ακόμη και ο ίδιος ο ΠΟΥ δεν πιστεύει πραγματικά σε αυτές τις δοκιμές. Απλώς διαβάστε το έγγραφο που δημοσιεύθηκε τον περασμένο Σεπτέμβριο ως εργαστηριακός οδηγός για το SARS-CoV-2 με τίτλο Διαγνωστικά τεστ για το SARS-CoV-2 – είναι διαθέσιμο στη διεύθυνση https://apps.who.int/iris/rest/bitstreams/1302661/  και λέει κυριολεκτικά στη σελίδα 5:

Testing for SARS-CoV-2. Nucleic acid amplification test (NAAT)

''Wherever possible, suspected active SARS-CoV-2 infections should be tested with NAAT, such as rRT-PCR. NAAT assays should target the SARS-CoV-2 genome. Since there is currently no known circulation of SARS-CoV-1 globally,  a sarbecovirus-specific sequence is also a reasonable target. For commercial assays, interpretation of results should be done according to the instructions for use. Optimal diagnostics consist of a NAAT assay with at least two independent targets on the SARS-CoV-2 genome, however, in areas with widespread transmission of SARS-CoV-2, a simple algorithm might be adopted with one single discriminatory target.»

''Όποτε είναι δυνατόν, η ύποπτη ενεργός λοίμωξη θα πρέπει να δοκιμάζεται με μια δοκιμή ενίσχυσης νουκλεϊκών οξέων (NAAT) όπως το RT-PCR. Οι δοκιμές NAAT πρέπει να στοχεύουν το γονιδίωμα SARS-CoV-2, αλλά επειδή δεν υπάρχει καμία γνωστή παγκόσμια κυκλοφορία του SARS-CoV-1 μια ακολουθία Sarbecovirus (η ακολουθία Sarbecovirus  υποτίθεται ότι περιλαμβάνει τουλάχιστον πέντε ιούς ανθρώπου και ζώου συμπεριλαμβανομένων των SARS-CoV-1 και SARS-Cov-2) είναι επίσης ένας λογικός στόχος''. 

Δηλαδή, ο ΠΟΥ συμφωνεί να χρησιμοποιήσει μη ειδικές ακολουθίες για την ανίχνευση του SARS-CoV-2.

Αλλά δεν συμβαίνει μόνο αυτό, επειδή το εγχειρίδιο αναφέρει αργότερα, 

''Μια βέλτιστη διάγνωση αποτελείται από μια δοκιμή NAAT με τουλάχιστον δύο στόχους ανεξάρτητους από το γονιδίωμα του SARS-CoV-2. Ωστόσο, σε περιοχές όπου η μετάδοση είναι ευρέως διαδεδομένη, ένας απλός αλγόριθμος ενός στόχου μπορεί να χρησιμοποιηθεί. Για εμπορικούς προσδιορισμούς, η ερμηνεία των αποτελεσμάτων πρέπει να γίνεται σύμφωνα με τις οδηγίες χρήσης. Τα βέλτιστα διαγνωστικά στοιχεία αποτελούνται από μια δοκιμασία NAAT με τουλάχιστον δύο ανεξάρτητους στόχους στο γονιδίωμα SARS-CoV-2, ωστόσο, σε περιοχές με ευρεία μετάδοση του SARS-CoV-2, ένας απλός αλγόριθμος μπορεί να υιοθετηθεί με έναν μόνο στόχο.''

Το εγχειρίδιο του ΠΟΥ αναφέρει, ''Ένα ή περισσότερα αρνητικά αποτελέσματα δεν αποκλείουν απαραίτητα τη μόλυνση SARS-CoV-2. Υπάρχουν διάφοροι παράγοντες που μπορούν να προκαλέσουν αρνητικό αποτέλεσμα σε ένα μολυσμένο άτομο, συμπεριλαμβανομένης της κακής ποιότητας του δείγματος, καθυστερημένη συλλογή του δείγματος, ανεπαρκής χειρισμός ή τεχνικοί λόγοι που είναι εγγενείς στη δοκιμή, όπως μετάλλαξη του ιού ή αναστολή της PCR. »

Αυτό σημαίνει ότι ένα επιβεβαιωμένο μη ειδικό αποτέλεσμα εξέτασης πωλείται επίσημα ως συγκεκριμένο.
Στο εσώκλειστο οδηγιών του οίκου NEWGENE για το Novel Coronavirus Antigen Detection Kit (Colloidal Gold), αναφέρει πως δεν παρατηρείται αλληλοεπίδραση με άλλα παθογόνα μέχρι συγκεκριμένη συγκέντρωση των παθογόνων αυτών. Δυστυχώς είναι ένας έμμεσος τρόπος αποφυγής παραδοχής αλληλοεπίδρασης με τα παθογόνα αυτά, σε συγκεντρώσεις μεγαλύτερες από τις αναφερόμενες.


Επομένως το ποιος παραπληροφορεί ποιόν, ας το κρίνουν οι αναγνώστες.

Οσο για το που σταματούν οι πληροφορίες μου ειλικρινά δεν είστε ικανοί να το γνωρίζετε. Εχω πάρα πολλές πληροφορίες ακόμη, και οι περισσότερες από αυτές είναι είναι ανέκδοτες και εσωτερικής πληροφόρησης.

Και πάλι ευχαριστώ για την ευκαιρία του επιστημονικού διαλόγου, ο ειλικρινής διάλογος προάγει την επιστήμη και όχι μόνο.

Και ας μην ξεχνάμε ότι οι άνθρωποι δεν κρίνονται από αυτά που λεγονται για αυτούς από την κριτική που τους γίνεται, ἠ από τις ασχήμιες που λέγονται για αυτούς, αλλά από τον τρόπο που οι ίδιοι απαντούν στην κριτική.

Και κυρίως από τον τρόπο που οι ίδιοι κρίνουν τους άλλους.

Ευαγγέλου Μαριάννα.

Ευχαριστώ το μπλόγκ για την ευκαρία που μου έδωσε να απαντήσω στις παραπληροφορίτικες δηλωσεις μου.


https://halithheia.blogspot.com/2021/03/e-pur-si-muove-pcr.html


Μπορεί να σε ενδιαφέρουν:

© Copyright 2010-2021 TheSecretRealTruth- Diberdayakan oleh Blogger